Methods Bacterial strains, plasmids and growth conditions E. coli DH5α, used in cloning procedures, was grown aerobically at 37°C in Luria-Bertani (LB) medium. L. monocytogenes EGD was kindly provided by S.J. Foster, University of Sheffield, United Kingdom.
L. monocytogenes EGD and its derivatives were grown in Brain Heart Infusion medium (BHI, Oxoid) at 37°C. Plasmids pNZ8048 [10] and pNZ9530 [12] were a kind gift from Michiel Kleerebezem, NIZO, Ede, The Netherlands. Plasmid pUC18 [24] was obtained from the collection of the Institute of Microbiology, University of Warsaw. Ampicillin (100 μg/ml) and chloramphenicol (10 μg/ml) were added to broth or agar media as required. When necessary, solid LB medium was supplemented with 0.1 mM IPTG (isopropyl b-D-1-thiogalactopyranoside) selleck and 20 μg/ml X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside). DNA manipulations and reagents Standard protocols were used for recombinant DNA techniques [25].
DNA fragments were isolated from agarose gels with the QIAquick Gel Extraction Kit (QIAGEN). DNA fragments from PCR and after enzymatic reactions were purified with the QIAquick PCR Purification Kit (QIAGEN). Plasmid DNA was isolated from E. coli with the Plasmid Miniprep Plus Kit (A&A Biotechnology). The isolation of chromosomal DNA from L. monocytogenes was performed as previously described [26]. Restriction enzymes, nuclease S1, T4 DNA ligase and Pfu DNA Selleckchem MK-8931 polymerase were purchased from Fermentas and used according to the manufacturer’s instructions. The oligonucleotide primers used in this study are shown in Table 2. Table 2 PCR primers used in this study Primer Sequence (5′→ 3′) HlyAa GCGGGTACCAGGTAGAGCGGACATCCATTG HlyBb, c, d GTTTTA GGATCC CCCGGGGGGTTTCACTCTCCTTCTAC HlyCb, CYTH4 c CCCGGG GGATCCTAAAACCGCTTAACACACACG HlyDe GCGTCTAGATTCTTCCCCGACAGAATCTGC NisR F CCCACTAAACAATCGGAGG NisK Rc GCGGGATCCCAGAAATTAAACCAAACAAAATTTTC Oepbp3 F CGTGAAACTAAATTTTAGAAAAAAGAAAAAAG Oepbp3 Rf GCGGCATGCGATTAATTTTCGGTTTGTTCTGATTG a Nucleotide substitutions to create KpnI site are underlined b Nucleotide substitutions
to create SmaI site are underlined c Nucleotide substitutions to create BamHI site are in boldface d Overhang complementary to SOE primer is in italics e Nucleotide substitutions to create XbaI site are underlined f Nucleotide substitutions to create SphI site are underlined Construction of plasmid pAKB carrying the nisin-controlled expression (NICE) system and its derivative pAKB-lmo1438 A strategy based on the amplification and cloning of PCR products was devised to construct a plasmid carrying the NICE system suitable for the overexpression of L. monocytogenes genes. With L. monocytogenes EGD genomic DNA as the template, primers HlyA and HlyB were used to BI 2536 chemical structure amplify a fragment of approximately 0.4 kb comprising the promoter region of the hly gene, and primers HlyC and HlyD were used to amplify a 0.