Adverse psychosocial working conditions have been identified as closely connected to musculoskeletal pain in previous studies (Bongers et al. 2002, 2006). There is some research suggesting that such adverse working conditions are related to musculoskeletal pain through their effects on perceived stress, that is, work stressors such as high job demands are hypothesized to cause high job stress, which in turn cause musculoskeletal pain through, for example, an increased muscle tension (Stewart et al. 2003a, b). Potential implications

for the interpretation of our results (the absence of a relationship QNZ between stress and reduced work ability/work performance, but a clear relationship between musculoskeletal pain and reduced work ability and work performance) may therefore be that participants in this study who report frequent musculoskeletal pain might have been exposed to a higher and more prolonged exposure to work-related stressors and that exposure to a high PF-3084014 datasheet job stress is more harmful when it is manifested also in HDAC inhibitor physical symptoms. Both clinical experience and the scientific literature

in the field indicate that exposure to adverse psychosocial working conditions often first expresses itself as physical sensations (Holte et al. 2003; Wahlstrom et al. 2003) and that these sensations may be the first “signs” of prolonged exposure to stress

Ribonuclease T1 and sometimes precede more severe stress-related mental conditions like exhaustion disorder/clinical burnout or depression, which often lead to sickness absence. Our findings therefore indicate the possibility that frequent musculoskeletal pain with or without long-standing stress as a contributing cause is associated with decreased work ability and work performance, while the perception of stress, not accompanied by pain (although other physical sensations or symptoms may exist), suggests an earlier and less severe stage in relation to these adverse outcomes. Work ability has been measured in many different ways in the literature sometimes by using the whole WAI (Ilmarinen 2007) and sometimes by using single questions (van den Berg et al. 2011). Moreover, in some studies, sick leave has been used as a measure of work ability, for example, in terms of not being on long-term sick leave or categorized by the amount of sick leave days in the preceding 12-month period (Lindberg et al. 2006). In this study, we chose to use the single item question included in the WAI that requests the responder to estimate the current perceived work ability compared to his/her best perceived work ability ever.

The fact that pRet42a transfer is also decreased in a derivative lacking

the pSym of GR64 (GR64-5), points to a chromosomal location of the putative inhibitor locus. Similarly, S. fredii pSfr64a was unable to perform conjugative transfer or induce transfer of pSfr64b in R. etli genomic background (CFN2001-3). Only R. etli pRet42a was still able to induce pSfr64b transfer in the R. etli background (CFN2001-2). The pSym of GR64 differs from the typical R. etli pSym To further analyze the bean-nodulating S. fredii strain GR64, we performed a phylogenetic analysis with chromosomal genes (recA, rpoB), and with the plasmid-encoded genes nifH and repB. The results (Figure 4) show that, based on the phylogeny of the chromosomal genes, GR64 clusters within the fredii clade, while nifH

this website and repB genes group strain GR64 with other bean-nodulating Sinorhizobium strains isolated from the South of Spain (Granada and Sevilla) [22, 23] and from the North of S3I-201 mw Africa (Tunisia) [24] (Figure 4C). The data obtained indicate that GR64 has a S. fredii chromosome but carries a pSym that allows nodulation of Phaseolus. However, this plasmid differs from typical R. etli pSyms in its replication genes, allowing it to coexist with plasmid pSfr64a, which does share its replication genes with the R. etli pSym. Another feature JQ1 in vitro that differentiates this pSym is the presence of a single copy of the nifH gene. Figure 4 Phylogeny of ROS1 S. fredii GR64. Maximum likelihood phylogenetic trees based on chromosomal: (A) recA, (B) rpoB, and plasmid: (C) nifH and (D) repB gene fragments. Arrows indicate the localization of S. fredii GR64, and R.etli CFN42. Discussion Genomic comparisons of S. meliloti, A. tumefaciens, and R. etli [25], and between Rhizobium

leguminosarum bv viciae and Rhizobium etli [26], have shown that chromosomes are well conserved both in gene content and gene order, whereas plasmids presented few common regions and lacked synteny, except for some pairs of plasmids whose features indicate that they were part of the ancestral genome, and may be considered as secondary chromosomes [26, 27]. In R. etli, the symbiotic and self-transmissible plasmids are the less conserved replicons [25] with fewer collinear blocks [26]. In this paper we show that a conjugative plasmid from a bean nodulating S. fredii strain is formed by large segments of replicons found in strains belonging to different species from diverse geographic origins. These replicons include two plasmids of R. etli, and a S. fredii chromosome. In GR64, bean-nodulation is provided by pSfr64b. Although the phylogenetic relationship of the GR64 nifH gene shows that it is closely related to the R. etli gene (Figure 4), pSfr64b differs from the typical R. etli pSym in other features (see above). We have previously reported that R.

1972). In addition, Arabidopsis thaliana is studied because it is widely used as one of the model organisms in plant sciences. Materials and methods Fluorescence lifetime imaging microscopy Multiphoton imaging was find more performed on a multiphoton dedicated Biorad Radiance 2100 MP system, coupled to a Nikon TE300 inverted microscope (Borst et al. 2003). A tunable Ti-Sapphire laser (Coherent Mira) was used as an excitation source which was pumped with a 5-Watt (Coherent) Verdi laser, resulting in excitation

pulses of ~200 fs at a repetition rate of 76 MHz. In the beam-conditioning unit (BCU), the excitation power was tuned by a pockell cell. The laser beam was collimated in the scanhead and focused by a Nikon 60x water immersion Apochromat objective lens (NA 1.2) into the sample. The fluorescence was detected by non-descanned direct detectors

(NDDs), which were coupled to the sideport of the microscope. Using this type of detection, learn more the loss of fluorescence light was reduced, and 3–5 times more signal was obtained compared to internal detectors. Luminespib concentration The emission light was split into two channels using a dichroic mirror filter wheel. FLIM measurements were performed by directing the fluorescence via a secondary dichroic (770DCXR, Chroma Technology Corp.) into a Hamamatsu R3809U photomultiplier, operated at 3.1 kV. Fluorescence was selected using a dichroic (FF 495—DiO2, Semrock) and 2x a bandpass filter (HQ700/75, Chroma Technology Corp). In the excitation branch, a longpass filter (RG 780 3 mm, Schott) was used for reduction of the excitation light. The multichannel-plate photomultiplier allows single photon detection at high time-resolution, with an IRF of 25 ps (van Meloxicam Oort et al. 2008, 2009). The output of the detector was coupled to a Becker & Hickl single-photon-counting module (SPC 830) (Becker and Bergmann 2002). The signal

from the Hamamatsu triggers the START of the time ramping for the time-correlated single-photon-counting (TCSPC). The pulses from the Ti-Sapphire laser serve as the SYNC signal to stop the time ramping and allowing the timing of the arrival of the fluorescent photons. The time window (ADC) was set to 1,024 channels and typically fluorescence was recorded for 2 min at a photon count rate of approximately 20 kHz. The signal from the PMT is combined with the pixel clock and line predivider signals from the Biorad scanhead to create 2D lifetime images. Fluorescence decay curves were fitted to a sum of N exponentials Σaiexp(−τ/τ i ) (i runs from 1 to N), convoluted with the IRF (Digris et al. 1999, van Oort et al. 2008, 2009), which was determined from the decay of pinacyanol iodide in methanol. From these results, an average lifetime <τ> was also calculated, according to <τ> = Σa i τ i . The number of counts in the peak channels is ~100 in the fluorescence intensities images and traces.

Paolo Marchetti has had advisory roles for www.selleckchem.com/products/GDC-0449.html Bristol-Myers Squibb, GlaxoSmithKine and Novartis. Alessandro Testori has received honoraria and travel reimbursement for advisory boards from Bristol-Myers Squibb. Paola Queirolo has served in a consultant or advisory role for Bristol-Myers Squibb, GlaxoSmithKline and Roche-Genentech. All remaining authors have declared no conflicts of interest. Authors’ IWP-2 supplier contributions All authors made substantial contributions to the

acquisition and interpretation of data, were involved in drafting the article or revising it critically for important intellectual content and provided final approval of the version to be published.”
“Background CELLFOOD™ (CF) is a unique, proprietary concentrate of 78 ionic minerals, 34 enzymes, 17 amino acids, electrolytes, and dissolved oxygen, held in a negatively-charged suspension utilizing deuterium, the only non-radioactive isotope of hydrogen. CF possesses antioxidant properties which protect erythrocytes, lymphocytes, and biomolecules against free radical attacks, suggesting that it may be an adjuvant intervention in the prevention and treatment of various physiological and pathological conditions related to oxidative stress [1]. The oral supplementation of CF for a period of six months significantly improves fibromyalgia symptoms Selleckchem SAR302503 and health-related Astemizole quality of life of fibromyalgic

patients compared to placebo [2]. CF treatment on leukemia cell lines induces cell death due to apoptotic mechanisms and altering cell metabolism through HIF-1α and GLUT-1 regulation [3]. However, the anti-cancer activities and potential anti-cancer mechanisms of the nutraceutical in solid tumors have not yet

been elucidated. Many physiological processes, including proper tissue development and homeostasis, require a balance between apoptosis and cell proliferation. All somatic cells proliferate via a mitotic process determined by progression through the cell cycle. Apoptosis (programmed cell death) occurs in a wide variety of physiological settings, where its role is to remove harmful, damaged or unwanted cells. Apoptosis and cell proliferation are linked by cell-cycle regulators and apoptotic stimuli that affect both processes. A failure in regulating proliferation together with suppression of apoptosis are the minimal requirements for a cell to become cancerous [4]. In the context of aberrant growth control, many important genes responsible for the genesis of various cancers have been discovered and the pathways through which they act characterized. Two proteins involved intimately in regulating cell proliferation are Akt and the tumor suppressor p53 (p53). The protein serine/threonine kinase Akt (also known as protein kinase B or PKB) plays an important role in averting cell death.

Our solution is comparable to other studies in regards to pattern characteristics. Red meat consumption and vegetable/fruit intake patterns have been identified previously [18] as has a dairy pattern [19], but the dessert pattern has yet to be identified to our knowledge. Our results agree with previous studies concluding females have better diet scores than males [8], although this was evident

in non-aesthetic sport females. Male non-aesthetic sport athletes had higher dessert, high-fat food, and dairy consumption scores than non-aesthetic sport females, indicating better selleck inhibitor eating choices for these three dietary patterns in this sub-group of male athletes. In comparison to their recreational athlete and non-athletic counter parts, college athletes are at increased risk for poor dietary patterns. Lack of discipline, social obligations, time constraints, perception of the impact of a healthful diet, and ready access to healthful food are cited as barriers to healthful eating selleck among college athletes [5]. Sports discipline is an important moderator when evaluating athlete nutrition, as unhealthful eating behaviors may be modeled from teammates [20]. Athletes often transition out of sport without adequate nutrition knowledge that may follow them for the rest of their lives [21], increasing risk of poor health outcomes. There are some limitations

to the data-driven approach to dietary pattern examination. Most studies use PCA, EFA, or CFA to derive latent factors. This study employed all three methods, a strength of the study. However, the patterns derived from these methods are not often predictive of a tangible outcome variable, such as BMI or waist circumference.

This is likely due to the fact that while dietary Methane monooxygenase patterns explain variation in eating behaviors, they are not specific to nor explain variation in learn more nutrients consumed. The lack of variability in BMI (wave-1 SD = 4.7; wave-2 SD = 4.5) may have suppressed differences between dietary patterns as well. Specific to this population of college athletes, energy needs may not be the same across different types of sport. Therefore, a diet consisting of more higher-fat foods may be more appropriate in the more physically demanding sports. Other methods of analyses and specific diet composition measurement methods should be considered as a valuable alternative [22]. Also, bias may exist in the self-reporting of dietary habits, possibly contributing to under-reporting of unhealthful eating behaviors and over-reporting of healthier behaviors. Conclusions The REAP demonstrated construct validity when measuring dietary patterns in a population of NCAA Division-I athletes. College athletes are a group that requires guidance in light of the increasing demands and expectations given dual roles as athlete and student. It is recommended that all athletes, regardless of sport, be screened for dietary intake behaviors.

Likewise, the Lipid Research Clinics Program[28] revealed that long-term physical activity, undertaken in a frequent and continuous manner, could decrease LDLc and TC levels. In the FVPs, we observed a

slight decrease (by 2.7 ± 15.2%; p > 0.05) in TC and a significant decrease (by 7.0 ± 18.1%; p = 0.034) in LDLc, changes which add up to an improvement in the LP. The fall in LDLc in the players is find more attributable to their physical activity having the effect on skeletal muscles of increasing Inhibitor Library price the amount and activity of lipoprotein lipase (LPL). This is an enzyme responsible for hydrolysing TG-rich lipoprotein, thereby reducing VLDL (very low-density lipoprotein) cholesterol and LDLc [29]. Furthermore, it appears that the number of weekly workouts is correlated with increased levels of

HDLc and decreased LDLc/HDLc and TC/HDLc atherogenic indices [30]. Specifically, the positive effects of exercise on lipid metabolism were found to last 48 hours [30]. Consistent with this, in our study, the FVPs did two workouts a day, six days a week and significant decreases were observed in their LDLc/HDLc (p = 0.011) and TC/HDLc (p = 0.004) indices, of 13.2 ± 15.4 and 9.5 ± 11.4 respectively. Theses decreases in their atherogenic Belnacasan indices can be considered a useful outcome, since high values are strongly associated with the risk of CVD [10]. The daily energy intake of the FVPs during the 11 weeks of study was Temsirolimus ic50 41 ± 6 kcal/kg of BW per day. González-Gross et al. [31] advocated an intake of 45 to 50 kcal/kg/day for athletes who train for more than 75 to 90 min/day, as was the case of the FVPs in our study. However, the 39 to 44 kcal/kg/day recommended by Volek et al. [32] for women who engage predominately in resistance exercise training seems more adequate for the first 11 weeks of training in the season in the case of women’s volleyball, because the subjects’ BW remained stable while their FM fell (kg). This was indicated by a significant

reduction (p = 0.027) in the Σ6SF, skin-fold thicknesses being used as indicators of body FM [33]. It is worth mentioning that total energy intake may also be directly related to the levels of TG, TC, HDLc, and LDLc, especially the amount and type of fat ingested [4]. Fat accounted for 35.5 ± 3.2% of total energy intake by the FVPs, in line with what has been reported by several other authors [34–38], but higher than the data reported by Beals et al. [39] and also higher than the 20 to 35% of the total energy consumed that is recommended for team athletes and for the general adult population [33]. Additionally, the amount of cholesterol and SFA intake was found to be positively correlated with the TC and LDLc [40]. The amount of cholesterol ingested by the FVPs was high (465 ± 57 mg) compared to the 300 mg recommended for the general population [2], similar to the 460 mg reported by Anderson et al.

strain FB24: chrJ, chrK, and chrL. Future work should focus on elucidating the exact physiological function of these genes. However, our research is an important first step in characterizing potential regulatory networks controlling efflux-mediated chromate resistance. We further illustrate the value of examining the genomic context of already characterized metal resistance genes in identifying Pevonedistat research buy new players in metal resistance

mechanisms. Methods Bacterial strains and growth conditions Bacterial strains and plasmids used in this study are listed in Table 3. Arthrobacter strains were cultured in 0.1X or 0.2X nutrient broth (NB) [Difco, Sparks, MD], Luria-Bertani (LB) medium pH 7.0, or modified Xenobiotic Basal Medium (mXBM). Modified XBM contained 10 mM glycerol phosphate, 10 mM KNO3, 6.0 mM NH4NO3, 0.01 mM CaCl2, 2 ml L-1 of EDTA Fe Citrate Solution [7.4 mM FeCl3, 11.4 mM Na2EDTA, 12.8 mM sodium citrate (C6H5O7Na3), 100 mM MgSO4, 5% NH4Cl2, 0.05 M CaCl2, 1.0 M NaCl, 1 M NaHCO3], 10 ml L-1 of vitamin solution (see Jerke [48] and Additional file 4 for components), 1 ml L-1 SL-7 trace elements [49], with

glucose (1.7 mM) as a carbon and energy source. Table 3 Bacterial strains and plasmids used in this study. Strain or plasmid Description Reference Arthrobacter        FB24 CrR [6] PD0332991 cost    D11 CrS derivative of FB24 This work E. coli   Methocarbamol      JM110 dam – dcm – Stratagene Plasmids

    pAOWA10128 7.3 kb Liproxstatin-1 research buy insert in pMCL200 obtained from DOE-JGI. Contains Arth_4248-Arth_4254. DOE-JGI pBluescript II SK+ 3.0 kb, ApR, lacZ, used for sublconing inserts prior to ligation into pART2. Promega pART2 4.6 kb, KmR, pCG100 ori, ColE1 ori, vector for expression in Arthrobacter [55] pKH11 10.6 kb PCR product from FB24 plasmid 3 (CP000457) containing Arth_4247-4255 in pBluescript II SK+ This worka pKH12 Insert from pKH11 cloned into pART2 This work pKH21 7.3 kb insert from pAOWA10128 in pBluescript II SK+ This work pKH22 Insert from pKH21 cloned into pART2 This work pKH32 3.7 kb EcoRI-KpnI fragment from pKH21 cloned into pART2. Contains Arth_4248-4249. This work pKH42 3.8 kb XhoI-BglII fragment from pKH21 cloned into pART2. Contains Arth_4251-Arth_4254. This work pKH52 8.3 kb insert from MluI-BglII digest of pKH11 to delete Arth_4252 and Arth_4252 cloned into pART2 This work pKH62 pKH22 digested with SfiI to delete Arth_4249-Arth_4252. This work pKH72 pKH12 digested with ScaI and XbaI to delete Arth_4247. This work aA schematic of each construct is presented in Figure 3. Induction of Cr(VI) resistance genes was assessed in Arthrobacter sp. strain FB24 cells by culturing in 150 ml NB to early mid-log phase (OD600, 0.3) at 30°C with shaking at 200 rpm. Cells were harvested by centrifugation, washed once with 0.2X NB and suspended in 15 ml 0.2X NB.

Chem Biodivers 3:593–610PubMed Degenkolb T, Gräfenhan T, Nirenberg HI, Gams W, Brückner H (2006b) Trichoderma brevicompactum complex: Rich source of novel and recurrent

plant-protective polypeptide antibiotics (peptaibiotics). J Agric Food Chem 54:7047–7061PubMed Degenkolb T, Dieckmann R, Nielsen KF, Gräfenhan T, Theis C, Zafari D, Chaverri P, Ismaiel A, Brückner H, von Döhren H, Thrane U, Petrini O, Samuels GJ (2008) The Trichoderma brevicompactum clade: a separate lineage with new species, new peptaibiotics, and mycotoxins. Mycol Prog 7:177–219 Degenkolb T, PXD101 mw Karimi Aghcheh R, Dieckmann R, Neuhof T, Baker SE, Druzhinina IS, Kubicek CP, Brückner H, von Döhren H (2012) The production of multiple small peptaibol families by single 14-module peptide synthetases in Trichoderma/Hypocrea. Chem Biodivers 9:499–535PubMed Ding G, Chen L, Chen A, Tian X, Chen X, Zhang H, Chen H, Liu XZ, Zhang Y, Zou ZM (2012) Trichalasins C and D from the plant endophytic fungus Trichoderma gamsii. Fitoterapia 83:541–544PubMed Ding G, Wang H, Li L, Song B, Chen H, Zhang H, Liu X, Zou Z (2014) Trichodermone, a spiro-cytochalasan

with a tetracyclic nucleus (7/5/6/5) skeleton from the plant endophytic fungus Trichoderma gamsii. J Nat Prod 77:164–167 el Hajji M, Rebuffat S, Lecommaneur D, Bodo B (1987) Isolation and sequence determination of trichorzianines Torin 2 supplier A, antifungal peptides from Trichoderma harzianum. Int J Pept Prot Methane monooxygenase Res 29:207–215 Elsila JE, Callahan MP, Glavin DP, MEK inhibitor clinical trial Dworkin JP, Brückner H (2011) Distribution and stable isotopic composition of amino acids from fungal peptaibiotics:

assessing the potential for meteoritic contamination. Astrobiology 11:123–133PubMed Figueroa M, Raja H, Falkinham JO III, Adcock AF, Kroll DJ, Wani MC, Pearce CJ, Oberlies NH (2013) Peptaibols, tetramic acid derivatives, isocoumarins, and sesquiterpenes from a Bionectria sp. (MSX 47401). J Nat Prod 76:1007–1015PubMed Fuji K, Fujita E, Takaishi Y, Fujita T, Arita I, Komatsu M, Hiratsuka N (1978) New antibiotics, trichopolyns A and B: isolation and biological activity. Experientia 34:237–239PubMed Fujita T, Takaishi Y, Okamura A, Fujita E, Fuji K, Hiratsuka N, Komatsu M, Arita I (1981) New peptide antibiotics, trichopolyns I and II, from Trichoderma polysporum. J Chem Soc Chem Comm 585–587 Fujita T, Takaishi Y, Ogawa T, Tokimoto K (1984) Fungal metabolites. 1. Isolation and biological activities of hypelcins A and B (growth inhibitors against Lentinus edodes) from Hypocrea peltata. Chem Pharm Bull 32:1822–1828 Fujita T, Iida A, Uesato S, Takaishi Y, Shingu T, Saito M, Morita M (1988) Structural elucidation of trichosporin-B-Ia, IIIa, IIId and V from Trichoderma polysporum.

7 −11.5 PND-1186 non-VGIIa 16.3 24.1 7.9 VGIIb 31.8 23.2 −8.6 non-VGIIc VGIIb B9076 VGIIb 30.0 18.8 −11.2 non-VGIIa 19.7 30.9 11.4 VGIIb 39.1 27.0 −12.1

non-VGIIc VGIIb B9157 VGIIb 29.1 16.6 −12.4 non-VGIIa 15.4 23.8 8.5 Sotrastaurin concentration VGIIb 30.3 21.3 −9.0 non-VGIIc VGIIb B9170 VGIIb 26.6 15.4 −11.2 non-VGIIa 16.9 24.8 7.9 VGIIb 31.0 22.7 −8.3 non-VGIIc VGIIb B9234 VGIIb 26.1 13.9 −12.2 non-VGIIa 15.3 23.8 8.5 VGIIb 30.2 21.2 −9.1 non-VGIIc VGIIb B9290 VGIIb 26.1 13.8 −12.3 non-VGIIa 15.1 24.5 9.5 VGIIb 30.6 21.2 −9.5 non-VGIIc VGIIb B9241 VGIIb 26.7 20.2 −6.5 non-VGIIa 14.5 24.0 9.4 VGIIb 30.5 21.4 −9.1 non-VGIIc VGIIb B9428 VGIIb 27.5 14.8 −12.6 non-VGIIa 16.0 24.3 8.2 VGIIb 32.0 22.4 −9.6 non-VGIIc VGIIb B6863 VGIIc 31.9 20.3 −11.5 non-VGIIa 33.4 20.2 −13.2 non-VGIIb 27.5 40.0 12.5 VGIIc VGIIc B7390 VGIIc 32.7 18.9 −13.8 non-VGIIa 31.1 17.9 −13.2 non-VGIIb 25.9 40.0 14.1 VGIIc VGIIc B7432 VGIIc 40.0 18.5 −21.5 non-VGIIa 30.7 17.6 −13.1 non-VGIIb 25.7 40.0 14.3 VGIIc VGIIc B7434 VGIIc 27.5 15.5 −12.0 non-VGIIa 28.5 15.4 −13.1 non-VGIIb 23.3 40.0 16.7 VGIIc VGIIc B7466 VGIIc 31.7 20.8 −10.9 non-VGIIa 33.5 20.6 −12.8 non-VGIIb 28.1 40.0 11.9 VGIIc VGIIc B7491 VGIIc 28.7 17.4 −11.2 non-VGIIa 30.4

16.9 −13.5 non-VGIIb 24.0 40.0 16.0 VGIIc VGIIc B7493 VGIIc 28.8 18.3 −10.6 non-VGIIa 31.1 18.0 −13.1 non-VGIIb 25.5 40.0 14.5 VGIIc VGIIc B7641 VGIIc 29.2 17.2 −12.0 non-VGIIa 30.0 17.2 −12.8 non-VGIIb 24.5 40.0 15.5 VGIIc VGIIc B7737 VGIIc 32.6 20.1 −12.5 non-VGIIa 30.8 20.5 −10.4 non-VGIIb 28.4 40.0 11.6 VGIIc VGIIc B7765 VGIIc 32.2 19.3 −12.8 non-VGIIa 32.3 18.9 −13.3 non-VGIIb 27.5 40.0 12.5 VGIIc VGIIc B8210 VGIIc 29.7 17.6 −12.0 non-VGIIa Napabucasin manufacturer 30.1 17.4 −12.7 non-VGIIb 25.9 40.0 14.1 VGIIc VGIIc B8214 VGIIc 30.1 17.5 −12.5 non-VGIIa 30.9 17.5 −13.4 non-VGIIb 26.1 40.0 13.9 VGIIc VGIIc B8510 VGIIc 29.6 17.5 −12.0 non-VGIIa 31.0 17.3 −13.7 non-VGIIb 24.5 40.0 15.5 VGIIc VGIIc B8549 VGIIc 29.9 17.7 −12.1 non-VGIIa 31.0 17.8 −13.2 non-VGIIb 24.8 40.0 15.2 VGIIc VGIIc B8552 VGIIc 29.2 17.1 −12.0 non-VGIIa 30.3 17.2 −13.1 non-VGIIb 24.4 40.0 15.6 VGIIc

VGIIc B8571 VGIIc 33.0 20.3 −12.7 non-VGIIa why 32.6 20.2 −12.5 non-VGIIb 28.1 40.0 11.9 VGIIc VGIIc B8788 VGIIc 29.1 17.3 −11.7 non-VGIIa 30.0 17.2 −12.8 non-VGIIb 25.0 40.0 15.0 VGIIc VGIIc B8798 VGIIc 36.5 22.8 −13.7 non-VGIIa 34.5 22.2 −12.3 non-VGIIb 31.0 40.0 9.0 VGIIc VGIIc B8821 VGIIc 37.7 24.5 −13.2 non-VGIIa 37.1 24.4 −12.7 non-VGIIb 33.0 40.0 7.0 VGIIc VGIIc B8825 VGIIc 29.6 17.7 −11.9 non-VGIIa 30.6 17.7 −12.9 non-VGIIb 25.8 40.0 14.2 VGIIc VGIIc B8833 VGIIc 29.0 17.0 −12.0 non-VGIIa 30.1 17.0 −13.1 non-VGIIb 25.2 40.0 14.8 VGIIc VGIIc B8838 VGIIc 32.0 19.5 −12.5 non-VGIIa 32.9 19.3 −13.7 non-VGIIb 28.7 40.0 11.3 VGIIc VGIIc B8843 VGIIc 32.4 19.9 −12.5 non-VGIIa 33.0 19.5 −13.5 non-VGIIb 28.6 40.0 11.4 VGIIc VGIIc B8853 VGIIc 32.8 21.5 −11.3 non-VGIIa 36.0 23.4 −12.6 non-VGIIb 33.1 40.0 6.9 VGIIc VGIIc B9159 VGIIc 27.4 20.3 −7.1 non-VGIIa 25.8 16.7 −9.1 non-VGIIb 20.5 34.5 14.0 VGIIc VGIIc B9227 VGIIc 25.6 13.6 −12.

Acinetobacter sp. Tol 5 and its derivative mutants were grown in

basal salt (BS) medium supplemented with toluene or LB medium at 28°C, as described https://www.selleckchem.com/products/PLX-4720.html previously [28]. E. coli strains were grown in LB medium at 37°C. Antibiotics were used at the following concentrations when required: gentamicin (100 μg/ml) and kanamycin (100 μg/ml) for Tol 5 derivative mutants; gentamicin (10 μg/ml) and kanamycin (50 μg/ml) for E. coli strains. Table 1 Bacterial strains and plasmids used in this study Strain FDA approved Drug Library Description Reference Acinetobacter sp.     Tol 5 Wild type strain [19] G4 A Tol 5 mutant constructed by insertion of a FRT site in the upstream of ataA of Tol 5, Gmr, SacB This study G4K1 A Tol 5 mutant constructed by additional insertion of a FRT site in the downstream of ataA of G4, Gmr, Kmr, SacB This study 4140 Unmarked ΔataA mutant of Tol 5 constructed by FLP/FRT recombination in G4K1 This study E. coli     DH5α Host BMS345541 solubility dmso for routine cloning TaKaRa S17-1 Donor strain for conjugation [4] Plasmid     pJQ200sk Mobile plasmid, SacB, Gmr [32] pK18mob Mobile plasmid, Kmr [33] pLOI2224 Source of FRT sites, Kmr [34] pFT-A Source of FLP recombinase and tetR, Ampr [34] pJQFRT Gene replacement

vector harboring a single FRT sequence, SacB, and Gmr This study pKFRT Mobile plasmid harboring a single FRT sequence, Kmr This study pKFRT/FLP Gene replacement vector harboring a single FRT sequence, FLP recombinase under the control of Ptet promoter, and Kmr This study pJQFRT_AtaAupstream A 1.0-kb fragment containing the upstream region of ataA ligated into the BamHI site of pJQFRT This study pKFRT/FLP_AtaAdownstream A 2.8-kb fragment containing the downstream region of ataA ligated into the BamHI site of pKFRT/FLP This study Genetic manipulation General DNA manipulations, such as PCR, restriction enzyme digestion, and ligation, were performed using standard protocols. The plasmids and primers used in this study are detailed in Table 1 and 2, respectively. Table 2 Primers Erythromycin used in this study Primer Sequence (5′ → 3′) FRT-leftF AATCCATCTTGTTCAATCATGC FRT-rightR

AATTCGAGCTCGGGAAGATC FRT-T7F AAATTAATACGACTCACTATAGG FRT-SP6R TACGATTTAGGTGACACTATAG Inv-pUC118F CAACGTCGTGACTGGGAAAAC Inv-pUC118R TCATGGTCATAGCTGTTTCCTG TetR-FLP2F CGATGGGTGGTTAACTCGAC TetR-FLP2R ACAGGACGGGTGTGGTCG AtaAupstF CGCGGATCCGATCTTCAAAGGTTGTGCTCAG AtaAupstF2 AACGCAAGTTGTTTTACTGC AtaAupstR CGCGGATCCTAGAAGCTGTAGCAGTTGTTCC AtaAdwstF CGCGGATCCACTCGACAGGGAAGATCTTC AtaAdwstR CGCGGATCCAATTGAATCATCAACACCTGCTG AtaAdwstR2 TACGTCGAGCAGCTAAGGTC Underlines indicate BamHI site. Construction of pJQFRT and pKFRT/FLP Two mobile plasmids, pJQ200sk [32] and pK18mob [33], were used as the plasmid backbone. To remove their original multiple cloning sites, inverse-PCR was performed using the primers Inv-pUC118F/Inv-pUC118R.